Fotos / Sonidos

Qué

Arañas Tejedoras Manchadas Género Neoscona

Autor

jmrobertia

Fecha

Agosto 12, 2021 04:54 PM AKDT

Fotos / Sonidos

Autor

madhipp11

Fecha

Julio 29, 2020 01:07 PM AKDT

Fotos / Sonidos

Autor

mbowser

Fecha

Julio 20, 2021 06:33 PM AKDT

Descripción

On gills of rainbow trout

Fotos / Sonidos

Fecha

Septiembre 4, 2021 02:33 PM HST

Fotos / Sonidos

Qué

Pulgones Familia Aphididae

Autor

sam907

Fecha

Julio 2021

Lugar

Alaska, US (Google, OSM)

Descripción

Fairly large gall-looking mass on a Populus tremuloides. Looks like it might be composed of its leaves, or maybe it is a gall of the petiole This could be potentially caused by a number of different insects; mites, aphids, midges, etc.

Fotos / Sonidos

Autor

muir

Fecha

Julio 4, 2021 12:55 PM AKDT

Fotos / Sonidos

Qué

Moscas de Sierra Suborden Symphyta

Autor

hubertszcz

Fecha

Agosto 16, 2021 12:01 PM CST

Fotos / Sonidos

Fecha

Agosto 16, 2021 04:45 PM AKDT

Fotos / Sonidos

Autor

danabrennan

Fecha

Septiembre 19, 2020 02:28 PM AKDT

Descripción

Pretty stumped on this one. Will get all the other obs I have throughout interior Alaska up soon.

Fotos / Sonidos

Autor

gwark

Fecha

Junio 21, 2021 09:36 PM AKDT

Descripción

found on violet rust which I had collected on 19 June (location is where rust was collected)

Fotos / Sonidos

Autor

siwanicki

Fecha

Agosto 30, 2021 04:19 PM AKDT

Fotos / Sonidos

Autor

gagraziano

Fecha

Junio 2, 2016 09:21 AM AKDT

Fotos / Sonidos

Autor

isqee

Fecha

Mayo 19, 2016 05:35 PM UTC

Fotos / Sonidos

Autor

gbryson

Fecha

Agosto 12, 2021 09:28 PM UTC

Fotos / Sonidos

Autor

hubertszcz

Fecha

Agosto 2, 2021 05:15 PM CST

Fotos / Sonidos

Autor

muir

Fecha

Julio 12, 2021 04:14 PM AKDT

Fotos / Sonidos

Qué

Moscas de Sierra Suborden Symphyta

Autor

muir

Fecha

Julio 30, 2021 09:14 AM AKDT

Fotos / Sonidos

Autor

danabrennan

Fecha

Julio 27, 2021 07:43 AM PDT

Descripción

On balsam poplar

Fotos / Sonidos

Autor

gwark

Fecha

Julio 28, 2021 12:37 PM AKDT

Fotos / Sonidos

Autor

muir

Fecha

Junio 29, 2021 05:55 PM AKDT

Fotos / Sonidos

Qué

Moscas de Sierra Suborden Symphyta

Autor

machi

Fecha

Julio 20, 2021 09:15 PM EDT

Descripción

Found in a Red Elderberry stand, but there was also Salmonberry and Alder here.

Fotos / Sonidos

Autor

ambersak

Fecha

Julio 26, 2021 01:58 PM AKDT

Lugar

Palmer (Google, OSM)

Descripción

On Lazy Mountain, hanging out in the alders

Fotos / Sonidos

Autor

sam907

Fecha

Julio 2021

Descripción

Large sized stem gall found on a wild raspberry plant. Gall was red in color and looked like almost like a strawberry on the outside. It was covered in thorns just like the stem and was hard to the touch. There were 3 more tiny galls on the stem just below the main mass (visible in the first and fourth pictures). This gall could be caused by a number of things (aphid, mite, midge, fungi, etc.) but I believe that an insect causing this gall is more likely then a fungus.

Fotos / Sonidos

Autor

machi

Fecha

Agosto 11, 2020 01:00 AM EDT

Descripción

On Nootka Rose

Fotos / Sonidos

Autor

hubertszcz

Fecha

Julio 1, 2021 10:17 AM CST

Fotos / Sonidos

Qué

Avispas Y Abejas de Cinturita Suborden Apocrita

Autor

russeld

Fecha

Julio 10, 2021 02:04 PM AKDT

Fotos / Sonidos

Qué

Moscas de Sierra Suborden Symphyta

Autor

hubertszcz

Fecha

Julio 20, 2021 10:03 AM CST

Fotos / Sonidos

Autor

jonathangoff

Fecha

Julio 19, 2021 04:58 PM PDT

Fotos / Sonidos

Autor

hubertszcz

Fecha

Julio 13, 2021 12:28 PM CST

Fotos / Sonidos

Qué

Mariposa Monarca Danaus plexippus

Autor

aspleha98

Fecha

Agosto 20, 2020 04:08 AM UTC

Fotos / Sonidos

Autor

sam907

Fecha

Junio 2021

Lugar

Alaska, US (Google, OSM)

Fotos / Sonidos

Autor

steelbirder

Fecha

Junio 13, 2021 04:18 PM CDT

Fotos / Sonidos

Autor

robertweeden

Fecha

Julio 5, 2021 12:14 PM AKDT

Descripción

15 mm
possibly Ammophila placida

This female parasitic wasp entered the hole pictured head first. It was underground very briefly (only 15-20 seconds) before emerging again, also head first. It flew off but returned shortly afterwards carrying a clump of sand in its jaws which it used to plug the hole.

https://bugguide.net/node/view/1996663

Fotos / Sonidos

Autor

csyampae

Fecha

Junio 14, 2021 06:16 PM UTC

Descripción

Possibly the first picture of the species in the wild

Fotos / Sonidos

Autor

csyampae

Fecha

Junio 5, 2021 08:40 PM UTC

Fotos / Sonidos

Qué

Golondrina Bicolor Tachycineta bicolor

Autor

karl93

Fecha

Mayo 31, 2021 10:33 AM AKDT

Fotos / Sonidos

Autor

abiabi

Fecha

Junio 1, 2021 04:33 PM AKDT

Descripción

6-1-21 Vespula intermedia - Northern Red-banded Yellowjacket. (my ID based on BugGuide & iNat observations)

Found inside the house this morning when it landed on the rim of my coffee cup! Fortunately it did not get drenched with hot coffee when my cup landed. This is the first time I have ever seen this type of Yellowjacket here.

Captured in jar and put in fridge to chill for portrait images. The Squares on the paper are 6mm to a side. The creature warmed up rapidly and kept turning away from camera lens so it was impossible to get a lateral view in focus. Will keep trying and then release this beautiful creature.

Fotos / Sonidos

Autor

muir

Fecha

Mayo 30, 2021 01:47 PM AKDT

Fotos / Sonidos

Autor

awenninger

Fecha

Junio 2020

Fotos / Sonidos

Autor

robertweeden

Fecha

Mayo 24, 2021 03:45 PM AKDT

Descripción

Measured at 6.5 mm

Found on muddy 4-wheeler track near Tanana River. Also submitted to BugGuide: https://bugguide.net/node/view/1972364

Fotos / Sonidos

Autor

muir

Fecha

Mayo 18, 2021 11:19 AM AKDT

Fotos / Sonidos

Autor

dssikes

Fecha

Mayo 10, 2021 03:55 PM AKDT

Fotos / Sonidos

Autor

jrfulkerson

Fecha

Mayo 2, 2021 06:06 PM AKDT

Fotos / Sonidos

Autor

bwelko

Fecha

Mayo 2020

Fotos / Sonidos

Qué

Mariquita de Tres Bandas Coccinella trifasciata

Autor

dssikes

Fecha

Abril 21, 2021 12:25 PM AKDT

Fotos / Sonidos

Autor

robertweeden

Fecha

Septiembre 7, 2019 11:59 PM AKDT

Descripción

FWL = 11 mm
aspen forest (We do have honey bees coming from the neighbors hives)
attracted to 100 W black light
Thanks to David W Droppers for id.
This is the only Vitula species recorded in Alaska by Ferris

Fotos / Sonidos

Autor

machi

Fecha

Julio 22, 2020 05:52 PM EDT

Fotos / Sonidos

Autor

machi

Fecha

Junio 19, 2019 07:42 PM EDT

Descripción

I think an animal dug up the nest and spread it around on the ground. Several of the cells still had bees in them, so I moved them to a protected mossy spot in the hopes some were still viable. I believe they were close to emerging already, as you can see in the photos that the one I did observe emerging seemed to be well developed. I did see one fully emerged one crawling among them that looked pretty dry. It was still a bit slow though.

Fotos / Sonidos

Autor

robertweeden

Fecha

Julio 12, 2020 02:43 PM AKDT

Descripción

Here is another interesting find for Alaska. Several species have records in Alaska on ARCTOS but I do not know what to look for to try and sort them out.

also submitted to BugGuide: https://bugguide.net/node/view/1941104

Fotos / Sonidos

Autor

robertweeden

Fecha

Agosto 3, 2020 12:13 AM AKDT

Descripción

Attracted to 100 W black light. According to the good folks at BugGuide, the host for this species is the Elm Sawfly.

https://bugguide.net/node/view/1869104#3084313

Fotos / Sonidos

Autor

jasonrgrant

Fecha

Agosto 3, 2020 08:40 PM AKDT

Descripción

On Populus tremuloides
@ceiseman

Fotos / Sonidos

Autor

annelised

Fecha

Septiembre 20, 2020 07:11 PM AKDT

Descripción

A dozen of individuals found in brown bear feces. Brown bear observation: https://www.inaturalist.org/observations/63616543

Fotos / Sonidos

Autor

muir

Fecha

Septiembre 4, 2020 01:22 PM AKDT

Fotos / Sonidos

Qué

Apolo Pequeño Parnassius phoebus

Autor

samdubbz

Fecha

Julio 12, 2017 04:47 PM EDT

Fotos / Sonidos

Autor

pauls_tucson

Fecha

Julio 15, 2007 10:42 AM MST

Fotos / Sonidos

Autor

robertweeden

Fecha

Mayo 9, 2020 06:05 PM AKDT

Descripción

FWl = 8 mm
when resting, this moth held its head low and its abdomen high

id courtesy of David W Droppers: https://www.butterfliesandmoths.org/sighting_details/1248003

Fotos / Sonidos

Autor

hm2flip

Fecha

Noviembre 14, 2020 08:32 PM AKST

Lugar

AK, US (Google, OSM)

Descripción

Caught off of Hooper Bay AK

Fotos / Sonidos

Autor

muir

Fecha

Julio 17, 2020 12:58 PM AKDT

Fotos / Sonidos

Autor

muir

Fecha

Julio 17, 2020 02:42 PM AKDT

Fotos / Sonidos

Autor

cynestor

Fecha

Agosto 9, 2007 11:45 AM PDT

Fotos / Sonidos

Autor

khalildashay

Fecha

Mayo 27, 2020 08:56 PM AKDT

Fotos / Sonidos

Autor

muir

Fecha

Septiembre 4, 2020 01:15 PM AKDT

Fotos / Sonidos

Qué

Catarina Californiana Coccinella californica

Fecha

Septiembre 1, 2020 03:11 PM AKDT

Descripción

Going with iNat’s tip suggestion, but input welcome.

Fotos / Sonidos

Autor

jasonrgrant

Fecha

Julio 26, 2020 10:33 PM AKDT

Descripción

Observations at Fielding Lake

Fotos / Sonidos

Autor

awenninger

Fecha

Agosto 19, 2020 09:30 AM AKDT

Fotos / Sonidos

Autor

robertweeden

Fecha

Mayo 2, 2020 07:24 PM AKDT

Descripción

6 mm FWL
40 F
aspen forest
id courtesy of Bob Biagi @ BugGuide

Fotos / Sonidos

Autor

stephcoates

Fecha

Agosto 27, 2020 11:42 AM AKDT

Descripción

At construction site

Fotos / Sonidos

Autor

danabrennan

Fecha

Agosto 6, 2020 11:19 AM PDT

Descripción

ID from lifescanner BOLD-DK1

Fotos / Sonidos

Autor

danabrennan

Fecha

Mayo 28, 2020 12:47 PM AKDT

Descripción

Host is Alaskan paper birch. Lifescanner ID Eriocraniidae from BOLD-F37. DNA barcode: COI-5P
AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATGCCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCG-

Fotos / Sonidos

Autor

danabrennan

Fecha

Agosto 26, 2020 11:42 AM AKDT

Descripción

Possible pupa from mine?

Fotos / Sonidos

Qué

Avispas Icneumónidas Familia Ichneumonidae

Autor

muir

Fecha

Agosto 29, 2020 09:01 AM AKDT

Fotos / Sonidos

Autor

danabrennan

Fecha

Agosto 6, 2020 11:42 AM AKDT

Fotos / Sonidos

Autor

danabrennan

Fecha

Agosto 17, 2020 01:53 PM AKDT

Descripción

On balsam poplar, several larvae per blotch mine

Fotos / Sonidos

Fecha

Julio 24, 2020 02:45 PM AKDT

Fotos / Sonidos

Autor

jmrobertia

Fecha

Julio 15, 2020 03:13 PM AKDT

Descripción

This wasp is the stuff of children's nightmares, lol. Saw several, apparently laying eggs in some cut (green) spruce log.

Fotos / Sonidos

Autor

muir

Fecha

Julio 17, 2020 12:33 PM AKDT

Lugar

Glen Alps (Google, OSM)

Fotos / Sonidos

Autor

robertweeden

Fecha

Julio 19, 2020 02:14 PM AKDT

Descripción

25mm

We had lots of Papilio canadensis around earlier in the summer - presumably this wasp has (or will) parasitize a crysalis from one of them.

An iNat first for Alaska.

See: https://bugguide.net/node/view/1858788

Fotos / Sonidos

Fecha

Julio 11, 2020 02:59 PM AKDT

Fotos / Sonidos

Autor

mbowser

Fecha

Julio 2, 2020 11:19 AM AKDT

Fotos / Sonidos

Autor

kim215

Fecha

Junio 27, 2020 07:09 PM AKDT

Fotos / Sonidos

Autor

danabrennan

Fecha

Junio 27, 2020 04:21 PM AKDT

Fotos / Sonidos

Autor

abiabi

Fecha

Agosto 27, 2019 07:00 PM AKDT

Descripción

8-27-19 Dolichovespula albida

Additional three images show top of the head & white patches behind the eyes, face & antenna markings & the tail patterns.

Feeding in Astilbe.

Would appreciate tips on which specific anatomical aspects of wasps to focus on for ease of ID.

Fotos / Sonidos

Qué

Polilla de Tienda del Oeste Malacosoma californica

Autor

k_russ21

Fecha

Junio 24, 2020 05:16 PM PDT

Fotos / Sonidos

Autor

achpeterson

Fecha

Junio 21, 2020 02:07 PM AKDT

Fotos / Sonidos

Autor

connietaylor

Fecha

Junio 23, 2020 02:39 PM AKDT

Fotos / Sonidos

Fecha

Junio 22, 2020 03:04 PM AKDT

Descripción

ID help welcome

Fotos / Sonidos

Qué

Polilla de Tienda del Oeste Malacosoma californica

Autor

madhipp11

Fecha

Junio 2, 2020 02:33 PM AKDT

Fotos / Sonidos

Autor

robertweeden

Fecha

Junio 3, 2020 04:28 PM AKDT

Descripción

Found a number of these all on alder. This is the preferred host for C. mainensis. Id is based on that and on the amount of spotting. See https://www.inaturalist.org/observations/46982760 for comparison.

Fotos / Sonidos

Autor

muir

Fecha

Junio 18, 2020 09:25 PM AKDT

Descripción

On birch leaves

Fotos / Sonidos

Autor

mbowser

Fecha

Junio 3, 2020

Descripción

Brought to me by a member of the public from the Marsh Lake Trail, where there are reports of thousands of these dark caterpillars, mostly on aspen.

Fotos / Sonidos

Autor

gwark

Fecha

Junio 2020

Fotos / Sonidos

Qué

Polilla de Tienda del Oeste Malacosoma californica

Autor

kaylabug

Fecha

Mayo 30, 2020

Descripción

There were hundreds of these little guys out by the highway out south of town! First time I have ever seen them here in my nearly 10 years of being in Ketchikan

Fotos / Sonidos

Autor

robertweeden

Fecha

Junio 15, 2020 03:18 PM AKDT

Fotos / Sonidos

Autor

mbowser

Fecha

Junio 9, 2020 10:10 PM AKDT

Fotos / Sonidos

Autor

dssikes

Fecha

Junio 15, 2020 09:58 AM AKDT

Fotos / Sonidos

Qué

Catarina de Cinco Manchas Hippodamia quinquesignata

Autor

muir

Fecha

Julio 9, 2014 03:21 PM AKDT

Fotos / Sonidos

Qué

Catarinas de Cuerpo Alargado Género Hippodamia

Autor

muir

Fecha

Junio 14, 2020 03:21 PM AKDT

Fotos / Sonidos

Autor

ahaberski

Fecha

Mayo 28, 2020 06:14 PM AKDT

Fotos / Sonidos

Fecha

Junio 9, 2020 10:21 AM AKDT

Descripción

Found dead while sweeping out under my washing machine. Not sure exactly how long it’s been there, but can’t have been more than a month or so. ID input welcome.

Fotos / Sonidos

Autor

troydeclan

Fecha

Mayo 28, 2020 12:37 PM AKDT